#change directory to this folder and exert the following command line:

bl2seq -i nt.2655203 -j nt.3283410 -p blastn -o bl2seq.out

#output->bl2seq.out

#if bl2seq work well, it will generate one new file named "bl2seq.out",
#please compared the contents between "bl2seq.out" and "result_bl2seq.out",
#the contents of this two files should be identical.

#then, exert the following command line:

formatdb -i nt.ests -p F -o T -n test.nt

#output->test.nt.nhr  test.nt.nsd  
#        test.nt.nin  test.nt.nsi
#        test.nt.nnd  test.nt.nsq
#        test.nt.nni  formatdb.log

#then, exert the following command line:

fastacmd -d test.nt -s 5986

#output->if fastacmd can work well, the following information should appear on the monitor:
#
######################################################################
#
#>gi|5986|emb|Z14321.1|Z14321 CEL11A10 Chris Martin sorted cDNA library Caenorhabditis 
#elegans cDNA clone cm11a10 5'
#CTTGAAGTTNTCGATAACAAATTTNTNATCCCAGAGAGAAAAGTGAACGAGGAGCCAATGTTTGCAGCGGANACGTTTAC
#TCGATCGTNGGGCGTGGAACAGTTATCACTGGAAAGCTTGAGAGAGGAATTTTNAAGAGAGGAGATAAGATTGAAATTNT
#TGGAGGAACAAAAGATGGAACCACTGTGAAATCAGTAATCTCTGGATTAGAATCCTTCCGTAAAACTGTCGATCAAGCCG
#AGCCTGGAGATCAATTGGNTGTGCTTCTTCGTGGTTTAGGNCCAAAAGATGTTCGTAGAGGATGTGTTTTACTTCCACAA
#GGNCACAAACATAAGGTCACTGATAAGGTTAAAGCTCAACTTTATGTGCTCAAAGAGAGC
#
#######################################################################

#then, exert the following command line:

blastall -p blastn -d test.nt -i test.ests -e 0.1 -o blastall.out

#output->blastall.out

#if blastall work well, it will generate one new file named "blastall.out",
#please compared the contents between "blastall.out" and "result_blastall.out",
#the contents of this two files should be identical.

